Top » Catalog » I2 » S6687

$18.00

S6687
[S6687]

S6687
hg38 Position: ChrY:15845889..15845889
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2c1a2
Comments: Below L596
Forward Primer: S6687_F TTCTTGTGATTCAGAGCAGAGG
Reverse Primer: S6687_R GAGGAGATCATGGCTTTCTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies