Top » Catalog » I2 » Y6644

$18.00

Y6644
[Y6644]

Y6644
hg38 Position: ChrY:13842873..13842873
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b2a3 (not listed)
Comments: Below L1317 > Y6647.
Forward Primer: Y6644_F TCGTAAGGCCAGTCTTCTGTC
Reverse Primer: Y6644_R TTATCCAGTCTTGGGCAGTTC
Reviews

Customers who bought this product also purchased
A7721
A7721
A7726
A7726
A7720
A7720
A7725
A7725
A7719
A7719
A7724
A7724
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies