Top » Catalog » I2 » A7719

$18.00

A7719
[A7719]

A7719
hg38 Position: ChrY:9297731..9297731
Ancestral: A
Derived: G
Reference: Wayne Roberts (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y6644
Forward Primer: A7719_F CCCTTGACTGACCTAAAATAGGG
Reverse Primer: A7719_R CTATTGGGAAAGGGATTCTGC
Reviews

Customers who bought this product also purchased
A7726
A7726
A7720
A7720
A7725
A7725
Y8332
Y8332
A7718
A7718
A7724
A7724
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies