Top » Catalog » I2 » A7721

$18.00

A7721
[A7721]

A7721
hg38 Position: ChrY:16525306..16525306
Ancestral: G
Derived: A
Reference: Wayne Roberts (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y6644
Forward Primer: A7721_F GATTGGCCACATTTTGATTG
Reverse Primer: A7721_R GCAAAAGTGGGAGGATTGAG
Reviews

Customers who bought this product also purchased
A7727
A7727
A7720
A7720
A7726
A7726
A7719
A7719
A7725
A7725
Y8332
Y8332
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies