Top » Catalog » I2 » A7723

$18.00

A7723
[A7723]

A7723
hg38 Position: ChrY:7301625..7301625
Ancestral: A
Derived: C
Reference: Wayne Roberts (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y6644
Forward Primer: A7723_F CACATGTCAATTCAGTATTGTTAACTG
Reverse Primer: A7723_R TGGGAGTTTCCCTGCTCAC
Reviews

Customers who bought this product also purchased
A7725
A7725
Y8332
Y8332
A7718
A7718
A7724
A7724
Y6644
Y6644
A7722
A7722
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies