Top » Catalog » I2 » A7724

$18.00

A7724
[A7724]

A7724
hg38 Position: ChrY:9605514..9605514
Ancestral: C
Derived: A
Reference: Wayne Roberts (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y6644
Forward Primer: A7724_F TCCATGAGGAAGGGACAATG
Reverse Primer: A7724_R CTGAAAAACTACACTTAACCTCACTGAG
Reviews

Customers who bought this product also purchased
A7719
A7719
A7725
A7725
Y8332
Y8332
A7718
A7718
A7723
A7723
Y6644
Y6644
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies