Top » Catalog » I2 » A7728

$18.00

A7728
[A7728]

A7728
hg38 Position: ChrY:19521423..19521423
Ancestral: A
Derived: G
Reference: Wayne Roberts (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y6644
Forward Primer: A7728_F AGGCTACAGGATTGCTTTGG
Reverse Primer: A7728_R TCGTGAATCAGTCAGCTCTTTC
Reviews

Customers who bought this product also purchased
Y8332
Y8332
A7718
A7718
A7723
A7723
Y6644
Y6644
A7722
A7722
A7727
A7727
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies