Top » Catalog » I2 » FGC6800

$18.00

FGC6800
[FGC6800]

FGC6800
hg38 Position: ChrY:9309609..9309609
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: I2a2a1b2a (not listed)
Comments: Below L801
Forward Primer: FGC6800_F GAGGTGGAATGTTGCTCATACC
Reverse Primer: FGC6800_R GGTGACAGAGTGTGACTCCAAAC
Reviews

Customers who bought this product also purchased
FGC33295
FGC33295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A9034
$18.00
Haplogroup Info
Other products
Currencies