Top » Catalog » I2 » Y5282

$18.00

Y5282
[Y5282]

Y5282
hg38 Position: ChrY:8114574..8114574
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b2a1a
Comments: Below L801
Forward Primer: Y5282_F GTATTCCAGAAATATTCCATAAACCAC
Reverse Primer: Y5282_R TTCCTTTGCTTCCCCAGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S12077
$18.00
Haplogroup Info
Other products
Currencies