Top » Catalog » I2 » A427

$18.00

A427
[A427]

A427
hg38 Position: ChrY:21120043..21120043
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: I2a2a1b1a1a
Comments: Below P78 > S25733. Aka Y4889
Forward Primer: A427_F CAAGTCAGGGATGTCATTCAAC
Reverse Primer: A427_R CATCAGTCTCCCCTGCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies