Top » Catalog » I2 » L159

$18.00

L159
[L159]

L159
hg38 Position: ChrY:13699084..13699084
Ancestral: T
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I2a1a
Comments: Found in I-L26 and R-L21*. Intercalation of a poly G with a dinucleotide STR.
Forward Primer: trA_L159_F TTGGCAGGTAGATCCGAGAG
Reverse Primer: trP1_L159_R AGGCTACAGTGAGCTGTGGTC
Reviews

Customers who bought this product also purchased
A430
A430
A817
A817
Z16433
Z16433
Z255
Z255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies