Top » Catalog » I2 » CTS1858

$18.00

CTS1858
[CTS1858]

CTS1858
hg38 Position: ChrY:11977500..11977500
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a2a1b2a1a2
Comments: Downstream of Y5282
Forward Primer: CTS1858_F CCTGCTAAGGTGCTGGGAG
Reverse Primer: CTS1858_R GGGTAGGAGAAAGGGGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies