Top » Catalog » I2 » FGC33305

$18.00

FGC33305
[FGC33305]

FGC33305
hg38 Position: ChrY:13681138..13681138
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y5282
Forward Primer: FGC33305_F TTCACTCCCGTGGTAAGGAG
Reverse Primer: FGC33305_R CTGACACTCAAGCATCTCTTCTG
Reviews

Customers who bought this product also purchased
Y15829
Y15829
Y15828
Y15828
Y15834
Y15834
Y15831
Y15831
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies