Top » Catalog » I2 » S8522

$18.00

S8522
[S8522]

S8522
hg38 Position: ChrY:3294569..3294569
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a2a1b2a1a1
Comments: Downstream of Y5282
Forward Primer: S8522_F TGAATGCGGAAACTGCTATG
Reverse Primer: S8522_R TTCTTCTTTCTGGGTCTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L1317
$18.00
Haplogroup Info
Other products
Currencies