Top » Catalog » I2 » A493

$18.00

A493
[A493]

A493
hg38 Position: ChrY:13084436..13084436
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1~
Comments: Downstream of CTS5966
Forward Primer: A493_F AAGGTGGCAAAACACCTGTC
Reverse Primer: A493_R GAGGCAGGAAACATCAAACC
Reviews

Customers who bought this product also purchased
CTS10228
CTS10228
Y6658
Y6658
A22782
A22782
A8740
A8740
PH908
PH908
Y97246
Y97246
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7190
1 x A7729
1 x DYS452
1 x DYS448
1 x FGC7174
1 x L181
$91.90
Haplogroup Info
Other products
Currencies