Top » Catalog » I2 » A8462

$18.00

A8462
[A8462]

A8462
hg38 Position: ChrY:6929136..6929136
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1 (not listed)
Comments: Below L233. Parallel to A417 and A7111
Forward Primer: A8462_F GGCAGGTCATCCTAAAGTCTAGC
Reverse Primer: A8462_R TTTGGGCACTGATGAGCAC
Reviews

Customers who bought this product also purchased
F25958
F25958
L1287
L1287
L160
L160
A14893
A14893
A16520
A16520
Y90935
Y90935
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies