Top » Catalog » I2 » A8462

$18.00

A8462
[A8462]

A8462
hg38 Position: ChrY:6929136..6929136
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1 (not listed)
Comments: Below L233. Parallel to A417 and A7111
Forward Primer: A8462_F GGCAGGTCATCCTAAAGTCTAGC
Reverse Primer: A8462_R TTTGGGCACTGATGAGCAC
Reviews

Customers who bought this product also purchased
Y33761
Y33761
A15050
A15050
Y4200
Y4200
FGC56815
FGC56815
I2a-CTS595 Panel
I2a-CTS595 Panel
A15076
A15076
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies