Top » Catalog » I2 » A8462

$18.00

A8462
[A8462]

A8462
hg38 Position: ChrY:6929136..6929136
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1 (not listed)
Comments: Below L233. Parallel to A417 and A7111
Forward Primer: A8462_F GGCAGGTCATCCTAAAGTCTAGC
Reverse Primer: A8462_R TTTGGGCACTGATGAGCAC
Reviews

Customers who bought this product also purchased
L1287
L1287
L160
L160
F25958
F25958
Y33761
Y33761
A15050
A15050
Y4200
Y4200
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies