Top » Catalog » I2 » A8611

$18.00

A8611
[A8611]

A8611
hg38 Position: ChrY:14135313..14135313
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b1a (not listed)
Comments: Below A1150
Forward Primer: A8611_F CCTGTCTCTGAACACAGAAGATAATTAC
Reverse Primer: A8611_R CATTCATAAGTAACTAAAGCCAAAATTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies