Top » Catalog » I2 » A8689

$18.00

A8689
[A8689]

A8689
hg38 Position: ChrY:13341272..13341272
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1a2a1 (not listed)
Comments: Below L1287
Forward Primer: A8689_F AGGCTCTGCAAGGCTCAG
Reverse Primer: A8689_R CAGTGTACCATCTGCTTGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies