Top » Catalog » I2 » A8691

$18.00

A8691
[A8691]

A8691
hg38 Position: ChrY:19601293..19601293
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1a2a1 (not listed)
Comments: Below L1287
Forward Primer: A8691_F GCTGTGTCTGGGAAATTCATAAG
Reverse Primer: A8691_R AAACTCGTACAAAAGGCAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies