Top » Catalog » I2 » A8740

$18.00

A8740
[A8740]

A8740
hg38 Position: ChrY:13786417..13786417
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b3a (not listed)
Comments: Below A356/Z16983
Forward Primer: A8740_F TGTGGAATGCAGAAATTCTAATG
Reverse Primer: A8740_R CCCCACACGGATTTTTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies