Top » Catalog » I2 » A8742

$18.00

A8742
[A8742]

A8742
hg38 Position: ChrY:16459275..16459275
Ancestral: A
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b1a (not listed)
Comments: Below A1150
Forward Primer: A8742_F TTGTGTCGCTGAGTCCATTC
Reverse Primer: A8742_R AGTGCAAATTTCCCACCTAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies