Top » Catalog » I2 » A9061

$18.00

A9061
[A9061]

A9061
hg38 Position: ChrY:16480873..16480873
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A9061_F AAACAACATGTGAGTGCATGG
Reverse Primer: A9061_R TGGCAGTTGAGTGAGGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies