Top » Catalog » I2 » A9062

$18.00

A9062
[A9062]

A9062
hg38 Position: ChrY:19042938..19042938
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A9062_F AAGCTCCTTCCTTCATGCTG
Reverse Primer: A9062_R AGGATGTCGGTGATTTACGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies