Top » Catalog » I2 » L1251

$18.00

L1251
[L1251]

L1251
hg38 Position: ChrY:3020557..3020557
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I2c1
Comments: Found in a hg I-P215 WTY participant
Forward Primer: L1251_F AACTTTTTCCAATCACGCATG
Reverse Primer: L1251_R TTTTTGTATCTTTAGTTGAGATGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies