Top » Catalog » I2 » A9403

$18.00

A9403
[A9403]

A9403
hg38 Position: ChrY:15199734..15199734
Ancestral: C
Derived: T
Reference: Colin Ferguson (2015)
ISOGG Haplogroup: I2a
Comments: Downstream of Y4750 > Y20072
Forward Primer: A9403_F GCCATCAAAAAGAATACAATTATGG
Reverse Primer: A9403_R CACATCTTACTCTTTCATCCTCCC
Reviews

Customers who bought this product also purchased
A9404
A9404
A9406
A9406
A9405
A9405
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies