Top » Catalog » I2 » A9404

$18.00

A9404
[A9404]

A9404
hg38 Position: ChrY:15323414..15323414
Ancestral: G
Derived: C
Reference: Colin Ferguson (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y4750
Forward Primer: A9404_F GCATGTGTAGAGGTTCTGAGGAG
Reverse Primer: A9404_R CATAGTTTTGAGCAAATTTGAAGG
Reviews

Customers who bought this product also purchased
A9406
A9406
A9405
A9405
A9403
A9403
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies