Top » Catalog » I2 » A9405

$18.00

A9405
[A9405]

A9405
hg38 Position: ChrY:19399035..19399035
Ancestral: G
Derived: A
Reference: Colin Ferguson (2015)
ISOGG Haplogroup: I2a
Comments: Downstream of Y4750 > A9406
Forward Primer: A9405_F GAAAACTGTAACACCCCACTGAC
Reverse Primer: A9405_R TGCATATAATTGCGTTTTCAATG
Reviews

Customers who bought this product also purchased
A9404
A9404
A9403
A9403
A9406
A9406
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies