Top » Catalog » I2 » A9406

$18.00

A9406
[A9406]

A9406
hg38 Position: ChrY:7913427..7913427
Ancestral: T
Derived: G
Reference: Colin Ferguson (2015)
ISOGG Haplogroup: I2a
Comments: Downstream of Y4750
Forward Primer: A9406_F GTACAACAGGCTTTTAGTTAACATGG
Reverse Primer: A9406_R GAAATCATACTGGAGGTAAACCCTAC
Reviews

Customers who bought this product also purchased
A9405
A9405
A9404
A9404
A9403
A9403
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies