Top » Catalog » I2 » A544

$18.00

A544
[A544]

A544
hg38 Position: ChrY:12048125..12048125
Ancestral: C
Derived: A
Reference: J. Melia (2014)
ISOGG Haplogroup: I2a1b2a
Comments: L161 subclade Isles C
Forward Primer: A544_F TCAGCATTCTGTGTGCAATTAAC
Reverse Primer: A544_R ATAGCCACAAACCCTCTTGG
Reviews

Customers who bought this product also purchased
FGC14463
FGC14463
S7714
S7714
Y14338
Y14338
S2679
S2679
FGC14457
FGC14457
A7729
A7729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies