Top » Catalog » I2 » FGC8041

$18.00

FGC8041
[FGC8041]

FGC8041
hg38 Position: ChrY:10018121..10018121
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FGC8041_F TCCCACAGGATAAGACTAGAGAGG
Reverse Primer: FGC8041_R CTGGCTAATTTTTTTTTGTATGTTTAGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies