Top » Catalog » I2 » FGC14457

$18.00

FGC14457
[FGC14457]

FGC14457
hg38 Position: ChrY:15633940..15633940
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclade C
Forward Primer: FGC14457_F TTGAGGGTATCAGTGCTGAGTG
Reverse Primer: FGC14457_R CACAATTATGCCCAGCTGC
Reviews

Customers who bought this product also purchased
Y91501
Y91501
Z17855
Z17855
BY153567
BY153567
A22770
A22770
A811
A811
A11115
A11115
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies