Top » Catalog » I2 » FGC14461

$18.00

FGC14461
[FGC14461]

FGC14461
hg38 Position: ChrY:15859808..15859808
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclade C
Forward Primer: FGC14461_F GGGGTCTGTCAGAAGGTGG
Reverse Primer: FGC14461_R TCAAGGAATCGCAGGTGATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF6952
1 x A21002
1 x S12480
$54.00
Haplogroup Info
Other products
Currencies