Top » Catalog » I2 » FGC14464

$18.00

FGC14464
[FGC14464]

FGC14464
hg38 Position: ChrY:18648487..18648487
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclade C
Forward Primer: FGC14464_F TTAGCTGTATTTCTGGCATTTTTG
Reverse Primer: FGC14464_R CAAAAAGGAAGAGTTTGGGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PLE05
1 x Y5367
$36.00
Haplogroup Info
Other products
Currencies