Top » Catalog » I2 » FGC7173

$18.00

FGC7173
[FGC7173]

FGC7173
hg38 Position: ChrY:8604629..8604629
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclades Isles C and D
Forward Primer: FGC7173_F GACAAGTAAACTCATTTGCTCAGAAG
Reverse Primer: FGC7173_R TCTGCCTCACCACTAGTTTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies