Top » Catalog » I2 » FGC7189

$18.00

FGC7189
[FGC7189]

FGC7189
hg38 Position: ChrY:12793993..12793993
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclade Isles D
Forward Primer: FGC7189_F TGCATTTCCTATTTTAGGTATGTCAC
Reverse Primer: FGC7189_R TGTAAGGTGAGGTTGGGAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L699
$18.00
Haplogroup Info
Other products
Currencies