Top » Catalog » I2 » FGC7216

$18.00

FGC7216
[FGC7216]

FGC7216
hg38 Position: ChrY:18995246..18995246
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclades Isles C and D
Forward Primer: FGC7216_F CTGCAACCTTCTCCTCTGGA
Reverse Primer: FGC7216_R TTTACATTCTCAAACTCACCCTATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY21564
$18.00
Haplogroup Info
Other products
Currencies