Top » Catalog » I2 » FGC7217

$18.00

FGC7217
[FGC7217]

FGC7217
hg38 Position: ChrY:19138762..19138762
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: discriminating for L161 subclade Isles D
Forward Primer: FGC7217_F GCTTATGTTACCACTCCTGTTGC
Reverse Primer: FGC7217_R AAGTGAACAAGCCATCTAAATCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies