Top » Catalog » I2 » PLE01

$18.00

PLE01
[PLE01]

PLE01
hg38 Position: ChrY:8669793..8669793
Ancestral: G
Derived: A
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > Y4882 > PLE04
Forward Primer: PLE01_F GGTTTTCTGCACAACCACAC
Reverse Primer: PLE01_R TCCATGGGACAATGAAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies