Top » Catalog » I2 » PLE05

$18.00

PLE05
[PLE05]

PLE05
hg38 Position: ChrY:15288266..15288266
Ancestral: T
Derived: G
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE05_F CTTGGCATGTCTTCAAGTTGC
Reverse Primer: PLE05_R ACAAAGGGAGACCCCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC965
$18.00
Haplogroup Info
Other products
Currencies