Top » Catalog » I2 » PLE07

$18.00

PLE07
[PLE07]

PLE07
hg38 Position: ChrY:16476731..16476731
Ancestral: C
Derived: G
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE07_F CTTTGGGAGGCTGAGTTGTG
Reverse Primer: PLE07_R GTGTCCTGCCCACCTTTG
Reviews

Customers who bought this product also purchased
A811
A811
P38
P38
S17250
S17250
Y16473
Y16473
M89
M89
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies