Top » Catalog » I2 » PLE07

$18.00

PLE07
[PLE07]

PLE07
hg38 Position: ChrY:16476731..16476731
Ancestral: C
Derived: G
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE07_F CTTTGGGAGGCTGAGTTGTG
Reverse Primer: PLE07_R GTGTCCTGCCCACCTTTG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
A7358
A7358
M438
M438
Y5596
Y5596
A1328
A1328
M304
M304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies