Top » Catalog » I2 » PLE07

$18.00

PLE07
[PLE07]

PLE07
hg38 Position: ChrY:16476731..16476731
Ancestral: C
Derived: G
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE07_F CTTTGGGAGGCTGAGTTGTG
Reverse Primer: PLE07_R GTGTCCTGCCCACCTTTG
Reviews

Customers who bought this product also purchased
Y152112
Y152112
FT14506
FT14506
Y6651
Y6651
Y108172
Y108172
F3145
F3145
Y126296
Y126296
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies