Top » Catalog » I2 » PLE08

$18.00

PLE08
[PLE08]

PLE08
hg38 Position: ChrY:17391823..17391823
Ancestral: T
Derived: G
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE08_F GGCACATTATTTGCTTCCTCAC
Reverse Primer: PLE08_R GAAAATCATCGTCGGATAGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A22230
1 x A18558
1 x FGC18107
1 x FGC71334
1 x A20193
1 x L1287
$108.00
Haplogroup Info
Other products
Currencies