Top » Catalog » I2 » PLE09

$18.00

PLE09
[PLE09]

PLE09
hg38 Position: ChrY:19196448..19196448
Ancestral: A
Derived: T
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE09_F CCCTATTTTTGTCTTCACTTAGGG
Reverse Primer: PLE09_R CCCATCCAGAAGATTTTCATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC44943
1 x M2058
1 x A20997
1 x M2016
$72.00
Haplogroup Info
Other products
Currencies