Top » Catalog » I2 » PLE10

$18.00

PLE10
[PLE10]

PLE10
hg38 Position: ChrY:19236742..19236742
Ancestral: C
Derived: T
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE10_F GAAAATAGCTTTCTCAAACACGTTG
Reverse Primer: PLE10_R AGCCAAGAACCCATACATTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies