Top » Catalog » I2 » PLE13

$18.00

PLE13
[PLE13]

PLE13
hg38 Position: ChrY:21033226..21033226
Ancestral: C
Derived: A
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE13_F TTCCATGACTTGTGAACATGG
Reverse Primer: PLE13_R GCACAAAGCTTCTTGTCAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies