Top » Catalog » I2 » PLE15

$18.00

PLE15
[PLE15]

PLE15
hg38 Position: ChrY:21585392..21585392
Ancestral: C
Derived: T
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE15_F CAGCTTGTTGCCTGGAGC
Reverse Primer: PLE15_R GGAGAAGCCAAGACATTTGATTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies