Top » Catalog » I2 » PLE17

$18.00

PLE17
[PLE17]

PLE17
hg38 Position: ChrY:9949342..9949342
Ancestral: G
Derived: A
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE17_F AGGTTGATCACACTACCACAGTTG
Reverse Primer: PLE17_R CCTGAGAGACATGGATTGAATTAC
Reviews

Customers who bought this product also purchased
S12617
S12617
PLE16
PLE16
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10732
1 x BY8537
1 x BY6337
$54.00
Haplogroup Info
Other products
Currencies