Top » Catalog » I2 » PLE17

$18.00

PLE17
[PLE17]

PLE17
hg38 Position: ChrY:9949342..9949342
Ancestral: G
Derived: A
Reference: Stanislaw J. Plewako (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PLE17_F AGGTTGATCACACTACCACAGTTG
Reverse Primer: PLE17_R CCTGAGAGACATGGATTGAATTAC
Reviews

Customers who bought this product also purchased
PLE16
PLE16
S12617
S12617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y21455
1 x Y10756
1 x A16633
1 x FGC16654
1 x PLE06
1 x M284
$108.00
Haplogroup Info
Other products
Currencies