Top » Catalog » I2 » A10034

$18.00

A10034
[A10034]

A10034
hg38 Position: ChrY:14401388..14401388
Ancestral: T
Derived: C
Reference: Zdenko Markovich (2016)
ISOGG Haplogroup: I2a1a2a1a (not listed)
Comments: Downstream L233 > Y4252 > A10033
Forward Primer: A10034_F CCATTTTATATGTAAACCCAAGCAC
Reverse Primer: A10034_R TCAGGCACAAATAGTTTACATGC
Reviews

Customers who bought this product also purchased
I2a-CTS595 Panel
I2a-CTS595 Panel
FGC56815
FGC56815
A19384
A19384
L233
L233
Y4200
Y4200
S2679
S2679
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L654.2
1 x GG198
1 x A20949
1 x S24
1 x SK1238
1 x A18713
1 x FGC752
1 x FT65953
1 x AM00523
1 x BY15879
$180.00
Haplogroup Info
Other products
Currencies