Top » Catalog » I2 » Y4252

$18.00

Y4252
[Y4252]

Y4252
hg38 Position: ChrY:19290103..19290103
Ancestral: A
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2
Comments: Downstream L233. Parallel to A8462. Upstream from A417 and A7111
Forward Primer: Y4252_F TTGGCTCTAACAGGGTGGAC
Reverse Primer: Y4252_R CGCAGTGATGGGGAACTTAC
Reviews

Customers who bought this product also purchased
M223
M223
I2 Superclade Panel
I2 Superclade Panel
Y138217
Y138217
Y54081
Y54081
FGC56855
FGC56855
L1286
L1286
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies