Top » Catalog » I2 » Y4252

$18.00

Y4252
[Y4252]

Y4252
hg38 Position: ChrY:19290103..19290103
Ancestral: A
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2
Comments: Downstream L233. Parallel to A8462. Upstream from A417 and A7111
Forward Primer: Y4252_F TTGGCTCTAACAGGGTGGAC
Reverse Primer: Y4252_R CGCAGTGATGGGGAACTTAC
Reviews

Customers who bought this product also purchased
FGC56855
FGC56855
L1286
L1286
A19385
A19385
A19485
A19485
A14893
A14893
A16520
A16520
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1247
$18.00
Haplogroup Info
Other products
Currencies